A Nextflow wrapper for Primer3
Primer3, is a little finicky to setup. This wraps the software installation & preparation. Currently, it is meant to produce PCR/Sanger sequencing primers around a target site for TIDE mutation detection, but presumably could be adapted to other uses cases without much trouble.
Dependencies:
- Miniconda , (can be installed by a user, see https://docs.conda.io/en/latest/miniconda.html)
- Nextflow , (once you have conda installed:
conda install -y nextflow)
nextflow run -resume primer3.nf --genome examples/example.fa --targetseq ATGGGAGGAGAAGGGTATCGCGG
Look in ./results once the pipeline is complete
Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M and Rozen SG. Primer3--new capabilities and interfaces. Nucleic Acids Res. 2012 Aug 1;40(15):e115. http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3424584/
Koressaar T and Remm M. Enhancements and modifications of primer design program Primer3. Bioinformatics 2007;23(10):1289-1291. https://www.ncbi.nlm.nih.gov/pubmed/17379693
Koressaar T, Lepamets M, Kaplinski L, Raime K, Andreson R and Remm M. Primer3_masker: integrating masking of template sequence with primer design software. Bioinformatics 2018;34(11):1937-1938. https://www.ncbi.nlm.nih.gov/pubmed/29360956
(Note, DAG rendering is a little broken currently)
